Mutation in KCNQ1 that has both recessive and dominant characteristics. (Letter to JMG).

Inherited forms of long QT syndrome (LQTS) are characterised by an extended QT interval and clinical manifestations that include syncope and sudden death. The known genes in which mutations give rise to LQTS all produce components of cardiac ion channels. (1-5) The two genes mutated in the majority of cases are KCNQ1 or HERG. (6) The proteins produced from these genes are subunits which form tetrameric transmembrane voltage gated potassium channels. KCNQ1 interacts with IsK (also called minK), the product of the KCNE1 gene, to produce ion channels that are responsible for the cardiac [I.sub.ks] current, which is one of the major delayed rectifying potassium currents responsible for phase 3 repolarisation of the heart. LQTS has been subdivided clinically into the dominantly inherited Romano-Ward syndrome (RWS) (7 8) and recessively inherited Jervell-Lange-Nielsen syndrome (JLNS). (9) Although the cardiac abnormalities are similar in the two conditions, JLNS also presents with bilateral deafness. Mutations in K CNQ1 produce JLNS as well as RWS, (10-12) although in the latter case there appears to be a strongly dominant negative effect exerted by the mutant protein, while this is very weak or absent in mutant proteins which produce JLNS. (13)

Three reports have shown that RWS can be inherited in a recessive manner. (14-16) One of these families was a compound heterozygote, where there were extended QT intervals seen for both heterozygotes, (14) but the other two families had no heterozygotes with QTc above 450 ms. (15 16) were therefore recessive both for the effect on QT interval and for clinical manifestations. None of these families showed deafness. The family described in the present report was first reported by Reardon et al (17) in 1993, the proband having had a cardiac arrest at 4 years, and she and her brother were then found to have a QTc of 490 ins. The parents of the proband were first cousins and there were hearing abnormalities reported in several family members. It was therefore difficult to determine whether the diagnosis should be RWS or JLNS. We looked for mutations in KCNQ1 to see if we could explain these diagnostic problems.

METHODS

Patient ascertainment

The family was originally reported as a result of a cardiac arrest in the proband that led to irreversible brain damage. (17) Both the proband and her treated, asymptomatic brother, who is now aged 16 years, were shown to have a prolonged QT interval (0.49 seconds). The proband, now deceased, was not known to have a hearing problem and audiometric testing of the brother shows no evidence of hearing loss.

Mutation analysis

Amplifications of the exons of KCNQ1 by PCR and subsequent SSCP and sequence analysis was exactly as reported previously. (18)

Production of mutant cDNAs

A mutation in KvLQTI isoform 1 was created in PCI-CMV-isol, a PCI plasmid containing isoform 1 of KCNQ1 using the TransformerTM Site-directed Mutagenesis Kit from Clontech. A 23 nucleotide primer sequence with the mutated nucleotide in the centre was used to mutate the normal KCNQ1 gene in the plasmid. A 26 nucleotide primer was used to co-mutate the unique restriction site in the plasmid. The primer was 5' CAGATCACTAGACGCTTTATTGCGG 3' which changed the normal Hindill site by substituting a C for the normal A. Minipreps were checked using PCR primers which amplified through the exon 5 region, followed by cutting of the amplicons with restriction enzyme to determine the presence of the mutation. After isoform 1 of KCNQ1 was changed to incorporate the mutation found in the proband and checked using restriction enzymes and sequencing, …