Somatic instability of the DNA sequences encoding the polymorphic polyglutamine tract of the AIB 1 gene.(Original Article)

Background: AIB1 contains a polymorphic polyglutamine tract (poly Q) that is encoded by a trinucleotide CAG repeat. Previously there have been conflicting results regarding the effect of the poly Q tract length on breast cancer. Since poly Q is not encoded by a perfect CAG repeat, the heterozygous polymorphic alleles need to be resolved, to understand the exact DNA sequences encoding poly Q.

Methods: Poly Q encoding sequences of AIB1 from 107 DNA samples, including breast cancer cell lines, sporadic primary breast tumours, and blood samples from BRCA1/BRCA2 mutation carriers and the general population, were resolved by PCR/cloning followed by sequencing of each individual clone.

Results: 25 distinct poly Q encoding sequence patterns were found. More than two distinct sequence patterns were found in a significantly higher proportion of tumours and cell lines than that of the general population, suggesting somatic instability. A significantly higher proportion of cancer cell lines or primary breast tumours than that of the general population contained rare sequence patterns. The proportion of sporadic breast tumours having at least one allele [less than or equal to]27 repeats is significantly higher than that in the blood of BRCA1/BRCA2 mutation carrier breast cancer patients or the general population.

Conclusion: The poly Q encoding DNA sequences are somatically unstable in tumour tissues and cell lines. A missense mutation and a very short glutamine repeat in primary tumours suggests that AIB1 activity may be modulated through poly Q, which in turn plays a role in the cotransactivation of gene expressions in breast cancers.

**********

J Med Genet 2003;40:885-890

The amplified in breast cancer gene 1 (AIB1; Genbank Accession number: AL034418), also known as RAC3, TRAM-1, or ACTR, belongs to a family of nuclear receptor co-activators that include the steroid receptor co-activator SRC-1 and transcription intermediate factor TIF-2. (1-4) These molecules directly bind to nuclear hormone receptors and stimulate hormone dependent transcriptional activation of the genes that have been implicated in the regulation of cell growth, development, differentiation, and homeostasis. (2) (4) The AIB1 gene was found to be amplified and over expressed in breast and ovarian cancer cell lines and in about 0-10% of breast cancer biopsies. (5) (6) The AIB1 protein interacts with the oestrogen receptor (OR) and enhances OR dependent transcription. Several characteristics of AIB1 are similar to the androgen receptor (AR). For example, both AIB1 and AR contain a polymorphic polyglutamine tract (poly Q). Both genes are involved in nuclear receptor mediated transactivation of gene expression. AIB1 is amplified in breast tumours, (5) (6) and AR is amplified in prostate cancer. (7) (8) These observations are consistent with the hypothesis that over expression of the gene may confer a proliferative advantage during hormone deprivation and contribute to the development of cancer recurrence. (8) Despite these similarities, the functional significance of the poly Q tract of AIB1 in transactivation of gene expression and its role in the development of breast cancer has not been established.

The expansion of CAG repeats in proteins containing poly Q underlies a number of neurodegenerative diseases. (9) The molecular mechanism of these proteins in these diseases is thought to be the formation of insoluble aggregates due to misfolded proteins that confer a gain in function. These novel toxic protein aggregates are ubiquitinated and found in neuronal intranuclear inclusions, leading to apoptosis and neurodegeneration. (9-12) The poly Q tract in the AR gene is unique in that the large expansion of poly Q encoding CAG repeat causes X-linked spinal bulbar muscular atrophy (SBMA, or Kennedy disease), (13) and the polymorphic poly Q of AR also plays an important role in the hormone-dependent transactivation. (14) (15) In transfection experiments, the length of the CAG repeats inversely correlates with transcriptional activity of AR. Longer poly Q repeats in AR are associated with lower transcriptional activity. (14) (15) In contrast, a shorter CAG repeat in AR is associated with a higher risk of an aggressive prostate cancer phenotype characterised by extra-prostatic extension, distant metastases, or poor histological grade. (16) Haiman et al. assessed the association between the poly Q repeat polymorphism in AIB1 gene and breast cancer risk. (17) They found that poly Q repeat genotype did not influence postmenopausal breast cancer risk among white women in the general population. However, a matched case control study of 448 BRCA1/BRCA2 mutation carriers found that women with at least 28 poly Q repeats in AIB1 had a higher risk of contracting breast cancer when compared to women who carried alleles with fewer poly Q repeats. (18) These studies measured the poly Q repeat size by fragment length analysis without analysing the encoding DNA sequence. Our approach to understanding the association of polymorphic poly Q tract of the AIB1 gene with breast cancer was to dissect the heterogeneous poly Q encoding sequences of individual alleles by cloning and sequencing. Our data demonstrates that the poly Q tract of AIB1 is not only polymorphic in repeat length, but also polymorphic in its encoding sequence. The triplet CAG repeat is somatically unstable in cell lines and primary tumours despite the frequent interruption by CAA.

MATERIALS AND METHODS

Samples and DNA preparation

A total of 107 DNA samples taken from 16 breast cancer cell lines (group A), 32 sporadic primary breast tumours (group B), 16 blood samples from familial breast cancer patients carrying BRCA1/BRCA2 mutation (group C), and 43 blood specimens from normal individuals in the general population (group D), were included in this study. The 16 cell lines used were MDA-MB157, BT20, BT474, BT549, T47D, MCF7-P19, HBL100, MDA-MB436, MDA-MB134V, MDA-MB231N, MDA-MB435, MDA-MB361, MDA-MB468, ZR75-1, ZR75-30, BT483. The age of the 32 patients with sporadic breast cancer ranged from 26 to 81 years with a mean of 56.0 (14.3) years. The age of the 16 breast cancer patients carrying BRCA1/BRCA2 mutations ranged from 35 to 76 years with a mean of 48.5 (12.3) years. The age of women from the general population ranged from 23 to 75 years with a mean of 54.5 (13.8) years. The B, C and D groups were matched for age, sex, and ethnicity (all are white), to enable comparison and statistical analysis. The tumour tissues were frozen in liquid nitrogen immediately after surgery and stored at -80[degrees]C until analysis. DNA was extracted from tumour tissues by proteinase K digestion, phenol chloroform extraction, and ethanol precipitation. DNA from blood lymphocytes and cell culture was extracted by the salting out method. (19)

Cloning and sequencing

The fragment containing poly Q was amplified by the forward primer F: 5' GTCTTATACCTGGTGTATTG 3' and the reverse primer R: 5' CTGGGGGAAGCAGTCACATTAG 3', yielding a PCR product …