AccessMyLibrary provides FREE access to over 30 million articles from top publications available through your library.
Environmental health magazine.
Set up an RSS feed
Create a link to this page
Copy and paste this link tag into your Web page or blog:
Leading the world's premier environmental health organization: a message from Linda Birnbaum.(Editorial)(Editorial)
April 1, 2009... doi: 10. 1289lehp. 12670
I am thrilled to be back at the National Institute of Environmental Health Sciences (NIEHS). I have always viewed NIEHS as the world's premier environmental health research organization. Although it has been 19...
PAH exposure.(Correspondence)
April 1, 2009... doi: 10. 1289lehp, 0800445
We were very interested to read the article by Choi et al. (2008). The difference between maternal exposure and our own data on actual concentrations of polycyclic aromatic hydrocarbons (PAHs) in the human male...
PAHs: Choi et al. respond.(Correspondence)
April 1, 2009... doi: 10. 1289/ehp.0800445R
We appreciate the comments of Fowler et al. In their letter, they compared the maximal maternal inhalation level of polycyclic aromatic hydrocarbons (PAHs) in Krakow, Poland (Choi et al. 2008), with the mean...
Linear low-dose extrapolation for noncancer responses is not generally appropriate.(Correspondence)
April 1, 2009... doi: 10.1289/ehp.0800329
I disagree with the assertion of White et al. (2009) that linear low-dose extrapolation is generally appropriate as a default for noncancer, as well as cancer, end points. Such a stance would radically alter a...
Linear low-dose extrapolation for non-cancer responses: Burke et al. respond.(Correspondence)
April 1, 2009... doi: 10. 1289lehp.0800329R
In his letter, Rhomberg raises several issues concerning recommendations in our report of the workshop "Issues and Approaches to Low Dose-Response Extrapolation for Environmental Health Risk Assessment" (White et...
Errata.(Correction notice)
April 1, 2009... In Table 1 of the article by Tarantini et al. [Environ Health Perspect 117:217-222 (2009)], the sequence for the iNOS forward primer should be AATGAGAGTTGTTGGGAAGTGTTT instead of AATGAGAGTTGTTGTTGGGAAGTGTTT.
The authors apologize for the...
What lies ahead for Nanotechnology?(RESEARCH INITIATIVES)
April 1, 2009... Nanotechnology, the engineering of functional materials at an atomic or molecular scale, has been among the fastest growing fields of science and technology. Worldwide sales of products incorporating nanotechnology are projected to total $2.6...
Cleaner air, longer life.(REGULATION)
April 1, 2009... Since the 1970s, a variety of measures for air pollution control have been introduced in an effort to improve air quality throughout the United States. Many epidemiologic studies already support the view that substantial health...
Study associates PFOS and PFOA with impaired fertility.(REPRODUCTIVE TOXICOLOGY)(perfluorooctane sulfonate)(perfluorooctanoate)
April 1, 2009... Recent decades have seen a substantial decline in the number of children being born to women in developed countries. Much of this decline is likely attributable to sociocultural changes and increased access to birth control. But some studies...
No cap and trade for mercury.(The Beat)(Brief article)
April 1, 2009... On 23 February 2009, the U.S. Supreme Court upheld a lower court ruling to dismiss a Bushera appeal to support a controversial plan to establish a cap-and-trade program for mercury emissions. Most U.S. mercury pollution derives from coal-fired...
Lead: down but not out.(The Beat)(Brief article)
April 1, 2009... Public health efforts to reduce lead exposure have resulted in a dramatic drop in average blood lead levels for U.S. children. A report in the March 2009 issue of Pediatrics now concludes that the number of children with blood lead above the...
B vitamins may cut AMD risk.(The Beat)(Age-related macular degeneration)(Brief article)
April 1, 2009... Age-related macular degeneration (AMD) is the leading cause of blindness in elderly Americans. Recent research has associated levels of homocysteine--a metabolic by-product linked with meat intake and blood vessel damage--with elevated risk of...
Winners in Cooling the Planet.(The Beat)(Brief article)
April 1, 2009... The winners of the U.K. Institution of Mechanical Engineers Cooling the Planet challenge were announced 5 March 2009. The competition was meant to inspire young scientists to develop engineering methods to reduce atmospheric greenhouse gas...
A U.S. ban for BPA?(The Beat)(Brief article)
April 1, 2009... Growing evidence links bisphenol A (BPA), an endocrine disruptor, to a range of adverse health effects. On 13 March 2009 companion bills were introduced into the U.S. House and Senate proposing to ban the use of BPA in all food and drink...
EPA to monitor air near schools.(The Beat)(Brief article)
April 1, 2009... Recent media coverage (e.g., EHP 116:A474 [2008]) has called attention to high levels of air pollution found around at least one in three U.S. schools. On 2 March 2009, the EPA announced a novel program to measure air pollution near 100 at-risk...
Developmental immunotoxicity in review.(CHEMICAL TESTING)(Report)
April 1, 2009... Much of the current knowledge regarding the adverse effects of environmental pollutants is based on laboratory evaluations performed using adult animals. But new clues now suggest that many diseases--including allergies, asthma, type 1...
Oil sands development: a health risk worth taking?(Focus)
April 1, 2009... As traditional petroleum supplies dwindled and prices soared over the past few years, oil companies have shifted their attention to oil sands, a mix of sand, water, and a heavy, viscous hydrocarbon called bitumen that can be converted to oil....
Nanotechnology-Related Environment, Health, and Safety Research: examining the national strategy.(Spheres of Influence)
April 1, 2009... Pick up a tube of sunscreen, a tennis racquet, an iPod, or any number of other consumer products, and there's a good chance that it's been "nano-enabled," meaning it contains nanoscale particles designed to give it some beneficial feature. An...
Widening the pool of factors: studies needed to assess asthma-swimming link.(Science Selections)
April 1, 2009... Several epidemiologic studies have suggested an association between childhood asthma and exposure to disinfection by-products (DBPs) in the swimming pool environment. In August 2007 a group of clinicians, epidemiologists, exposure scientists,...
It all adds up over time: cumulative lead exposure and cognition in older women.(Science Selections)
April 1, 2009... Many older people in the U.S. population were chronically exposed to lead from paint and gasoline prior to the 1980s. To date, most of the research on lead and cognitive functioning in older age has focused on men, despite the fact that women...
Dramatic devices? Medical procedures may expose infants to BPA.(Science Selections)(bisphenol A)(Report)
April 1, 2009... The industrial chemical bisphenol A (BPA) is widely used to make polycarbonate plastic and epoxy resins. Low-level exposure to BPA has been shown to cause endocrine disruption in animal experiments, resulting in abnormal development of the...
Climate change and agricultural agents: planning for future interactions.
April 1, 2009... Global climate change is expected to causeas increasingly extreme oscillations in atmospheric temperatures as well as increased frequencies and intensities of storms and natural disasters. Other effects may be felt in more indirect ways, such...
A new spin on research translation: the Boston Consensus Conference on Human Biomonitoring.(Commentary)(Conference news)
April 1, 2009... BACKGROUND: Translating research to make it more understandable and effective (research translation) has been declared a priority in environmental health but does not always include communication to the public or residents of communities...
Childhood asthma and environmental exposures at swimming pools: state of the science and research recommendations.(Report)
April 1, 2009... OBJECTIVES: Recent studies have explored the potential for swimming pool disinfection by-products (DBPs), which are respiratory irritants, to cause asthma in young children. Here we describe the state of the science on methods for understanding...
Impacts of climate change on indirect human exposure to pathogens and chemicals from agriculture.(Report)
April 1, 2009... OBJECTIVE: Climate change is likely to affect the nature of pathogens and chemicals in the environment and their fate and transport. Future risks of pathogens and chemicals could therefore be very different from those of today. In this review,...
Time- and dose-related effects of Di-(2-ethylhexyl) phthalate and its main metabolites on the function of the rat fetal testis in vitro.(Research)(Report)
April 1, 2009... BACKGROUND: Endocrine-disrupting effects of phthalates are understood primarily from in utero exposures within the fetal rat testis. Nevertheless, their path of action, dose--response character, and cellular target(s) within the fetal testis...
Predicting chronic fine and coarse particulate exposures using spatiotemporal models for the northeastern and midwestern United States.(Research)(Report)
April 1, 2009... BACKGROUND: Chronic epidemiologic studies of particulate matter (PM) are limited by the lack of monitoring data, relying instead on citywide ambient concentrations to estimate exposures. This method ignores within-city spatial gradients and...
Toxicity of tungsten carbide and cobalt-doped tungsten carbide nanoparticles in mammalian cells in vitro.(Research)(Report)
April 1, 2009... BACKGROUND: Tungsten carbide nanoparticles are being explored for their use in the manufacture of hard metals. To develop nanoparticles for broad applications, potential risks to human health and the environment should be evaluated and taken...
BME estimation of residential exposure to ambient [PM.sub.10] and ozone at multiple time scales.(Research)(Bayesian maximum entropy)
April 1, 2009... BACKGROUND: Long-term human exposure to ambient pollutants can be an important contributing or etiologic factor of many chronic diseases. Spatiotemporal estimation (mapping) of long-term exposure at residential areas based on field observations...
Structure-activity-dependent regulation of cell communication by perfluorinated fatty acids using in vivo and in vitro model systems.(Research)(Report)
April 1, 2009... BACKGROUND: Perfluoroalkanoates, [e.g., perfluorooctanoate (PFOA)], are known peroxisome proliferators that induce hepatomegaly and hepatocarcinogenesis in rodents, and are classic non-genotoxic carcinogens that inhibit in vitro gap-junctional...
PAH-DNA adducts, cigarette smoking, GST polymorphisms, and breast cancer risk.(Research)(Polycyclic aromatic hydrocarbons)(glutathione S-transferases )(Report)
April 1, 2009... BACKGROUND: Polycyclic aromatic hydrocarbons (PAHs) may increase breast cancer risk, and the association may be modified by inherited differences in deactivation of PAH intermediates by glutathione S-transferases (GSTs). Few breast cancer...
A biomarker validation study of prenatal chlorpyrifos exposure within an inner-city cohort during pregnancy.(Research)(Report)
April 1, 2009... BACKGROUND: We previously documented significant decreases in chlorpyrifos concentrations in maternal personal and indoor air samples among pregnant African-American and Dominican women from New York City after the 2000-2001 restrictions on its...
Prevalence of metabolic syndrome associated with body burden levels of dioxin and related compounds among Japan's general population.(Research)(Report)
April 1, 2009... BACKGROUND: Environmental exposure to some persistent organic pollutants has been reported to be associated with metabolic syndrome in the U.S. population.
OBJECTIVES: We evaluated the associations of body burden levels of dioxins and...
Cumulative exposure to lead in relation to cognitive function in older women.(Research)(Report)
April 1, 2009... BACKGROUND: Recent data indicate that chronic low-level exposure to lead is associated with accelerated declines in cognition in older age, but this has not been examined in women.
OBJECTIVE: We examined biomarkers of lead exposure in...
Cancer incidence among pesticide applicators exposed to permethrin in the Agricultural Health Study.(Research)(Report)
April 1, 2009... BACKGROUND: Permethrin is a synthetic pyrethroid insecticide widely used in agriculture, in public health, and in many U.S. homes and gardens.
OBJECTIVE: In this study we evaluated the incidence of cancer among pesticide applicators...
Oxidative and excitatory mechanisms of developmental neurotoxicity: transcriptional profiles for chlorpyrifos, diazinon, dieldrin, and divalent nickel in PC12 cells.(Research)(Report)
April 1, 2009... BACKGROUND: Oxidative stress and excitotoxicity underlie the developmental neurotoxicity of numerous chemicals.
OBJECTIVES: We compared the effects of organophosphates (chlorpyrifos and diazinon), an organochlorine (dieldrin), and a metal...
The relationship of housing and population health: a 30-year retrospective analysis.(Research)(Survey)
April 1, 2009... OBJECTIVE: We analyzed the relationship between health status and housing quality over time.
METHODS: We combined data from two nationally representative longitudinal surveys of the U.S. population and its housing, the National Health and...
Persistent organic pollutant residues in human fetal liver and placenta from greater Montreal, Quebec: a longitudinal study from 1998 through 2006.(Research)(Report)
April 1, 2009... BACKGROUND: There is general concern that persistent organic pollutants (POPs) found in the environment, wildlife, food, water, house dust, human tissues, and fluids may alter normal human physiologic activities (e.g., fetal development, immune...
Direct impairment of vascular function by diesel exhaust particulate through reduced bioavailability of endothelium-derived nitric oxide induced by superoxide free radicals.(Research)(Report)
April 1, 2009... BACKGROUND: Diesel exhaust particulate (DEP) is a key arbiter of the adverse cardiovascular effects of air pollution.
OBJECTIVES: We assessed the in vitro effects of DEP on vascular function, nitric oxide (NO) availability, and the...
Preparing for climate change: a perspective from local public health officers in California.(Research)(Report)
April 1, 2009... BACKGROUND: The most recent scientific findings show that even with significant emission reductions, some amount of climate change is likely inevitable. The magnitude of the climate changes will depend on future emissions and climate...
Direct effects, compensation, and recovery in female fathead minnows exposed to a model aromatase inhibitor.(Research)(Report)
April 1, 2009... BACKGROUND: Several chemicals in the environment have the potential to inhibit aromatase, an enzyme critical to estrogen synthesis.
OBJECTIVES: The objective of this study was to provide a detailed characterization of molecular and...
Arsenic exposure within the Korean community (United States) based on dietary behavior and arsenic levels in hair, urine, air, and water.(Research)(Report)
April 1, 2009... BACKGROUND: Determining arsenic exposure in groups based on geographic location, dietary behaviors, or lifestyles is important, as even moderate exposures may lead to health concerns.
OBJECTIVES/METHODS: The Korean community in Washington...
Exposure to bisphenol A and other phenols in neonatal intensive care unit premature infants.(Children's Health)(Report)
April 1, 2009... OBJECTIVE: We previously demonstrated that exposure to polyvinyl chloride plastic medical devices containing di(2-ethylhexyl) phthalate (DEHP) was associated with higher urinary concentrations of several DEHP metabolites in 54 premature infants...
Predicting plasma concentrations of bisphenol a in children younger than 2 years of age after typical feeding schedules, using a physiologically based toxicokinetic model.(Children's Health)(Report)
April 1, 2009... BACKGROUND: Concerns have recently been raised regarding the safety of potential human exposure to bisphenol A (BPA), an industrial chemical found in some polycarbonate plastics and epoxy resins. Of particular interest is the exposure of young...
Risk of asthmatic episodes in children exposed to sulfur dioxide stack emissions from a refinery point source in Montreal, Canada.(Children's Health)(Report)
April 1, 2009... BACKGROUND: Little is known about the respiratory effects of short-term exposures to petroleum refinery emissions in young children. This study is an extension of an ecologic study that found an increased rate of hospitalizations for...
Correlations between prenatal exposure to perfluorinated chemicals and reduced fetal growth.(Children's Health)(Report)
April 1, 2009... BACKGROUND: Perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) are man-made, ubiquitous, and persistent contaminants in the environment, wildlife, and humans. Although recent studies have shown that these chemicals interfere with...
Acute effects of air pollution on pulmonary function, airway inflammation, and oxidative stress in asthmatic children.(Children's Health)
April 1, 2009... BACKGROUND: Air pollution is associated with respiratory symptoms, lung function decrements, and hospitalizations. However, there is little information about the influence of air pollution on lung injury.
OBJECTIVE: In this study we...
Calendar 2009.(Calendar)
April 1, 2009... April
18-19 April, Sat-Sun. Unite for Sight 6th Annual Global Health and Development Conference: Achieving Global Goals Through Innovation. Information: Unite for Sight, 31 Brookwood Drive, Newtown, CT 06470 USA, e-mail:...
Pharma-Ecology--The Occurrence and Fate of Pharmaceuticals and Personal Care Products in the Environment.(Book review)
April 1, 2009... Pharma-Ecology--The Occurrence and Fate of Pharmaceuticals and Personal Care Products in the Environment
By Patrick K. Jjemba
Hoboken, NJ: John Wiley & Sons, 2008.
314 pp. ISBN: 978-0-470-04630-2, $95
Pharmaceuticals and...
New books.(Bibliography)
April 1, 2009... Agenda for a Sustainable America
John Dernbach
Washington, DC:Island Press, 2009. 520 pp.
ISBN: 978-1-58576-133-3, $52.95
Bioinformatics: A Concept-Based Introduction
Venkatarajan Mathura, Pandjassamme Kangueane
New...